Official Journal of the Japan Wood Research Society
Table 2 Sequences of sense primers, anti-sense primers and probes for the quantitative PCR analyses
From: Quantitative evaluation of properties of residual DNA in Cryptomeria japonica wood
Amplicon length (bp) | Sense primer | Anti-sense primer | Probe |
|---|---|---|---|
93 | GAAAACGTGAATTCCCAACCATT (nucleotide positions 580–602) | CTCACCCGTCTCAGCCTGA (nucleotide positions 672–654) | ACAAAAGCAGAAACGATCTCTCCAGCGC (nucleotide positions 633–606) |
185 | CCAAGGCCCACCACATGG (nucleotide positions 414–431) | GTTGGGAATTCACGTTTTCATCATC (nucleotide positions 598–574) | TCCACCACGGAGACATTCATAAACCGCT (nucleotide positions 558–531) |
317 | CGGATTCCTCCTGCTTATTCAAAA (nucleotide positions 385–408) | GCAGTAGCATTCAGGTAATGTCC (nucleotide positions 701–679) | TCCAAGGCCCACCACATGGTATTCAAGT (nucleotide positions 413–440) |