Official Journal of the Japan Wood Research Society
Table 2 Sequences of sense primers and anti-sense primers for the polymerase chain reaction (PCR)
From: Sequencing and quantifying plastid DNA fragments stored in sapwood and heartwood of Torreya nucifera
Target | Amplicon length (bp) | Sense primer | Anti-sense primer |
|---|---|---|---|
rbcL | 370 | GGTACATGGACCACTGTTTG (nucleotide positions 190-208) | TACCATAATTCTTGGCGGAT (nucleotide positions 559-540) |
trnL-trnF | 372 | CTTTTCATAATTCTGTGAGCAA (nucleotide positions 568-589) | GTCCTCTGCTCTACCAACTG (nucleotide positions 939-920) |
psbA-trnH | 379 | TTCAGCTATGGATGCTAAATAAAGC (nucleotide positions 269-293) | CGCATGGTGGATTCACAATCC (nucleotide positions 647-627) |