Official Journal of the Japan Wood Research Society
Table 3 Sequences of sense primers, anti-sense primers, and probes for the quantitative polymerase chain reaction (PCR) analyses
From: Sequencing and quantifying plastid DNA fragments stored in sapwood and heartwood of Torreya nucifera
Target | Amplicon length (bp) | Sense primer | Anti-sense primer | Probe |
|---|---|---|---|---|
rbcL | 99 | TTACCAGTCTTGATCGTTACAAGG (nucleotide positions 221-244) | GATCTAAAGGGTAAGCTACATAGGC (nucleotide positions 319-295) | CCAGGAACGGGCTCAATATCATAGCATCG (nucleotide positions 275-247) |
trnL-trnF | 111 | CGGAATTCTCACTTTATTTTAAATAGCGC (nucleotide positions 592-620) | CAATTGCTCCTACGATCAACTTGTC (nucleotide positions 702-678) | ACCCCACTATTTTTTGCTAAATAGCAAAATAGATC (nucleotide positions 639-673) |
psbA-trnH | 93 | CTTGGAAGGAATGACCGTAGACA (nucleotide positions 555-577) | CGCATGGTGGATTCACAATCC (nucleotide positions 647-627) | CCTTTGAACCACTTGGCTACGTCCGC (nucleotide positions 622-597) |